5 Mar 2021 Complete information for API5 gene (Protein Coding), Apoptosis Inhibitor 5, including: function, proteins, disorders, pathways, orthologs, and

Abscisic acid (ABA) and stress response from late embryonic growth through early seedling development is regulated by a signaling network that includes the Arabidopsis ABA-insensitive (ABI)5 gene, which encodes a basic leucine zipper transcription factor.

Displaying 1 - 25. To see ESTs associated with your gene of interest, click on the Locus link. Transcription factor that possesses transactivation activity in yeast (PubMed: 17604002, PubMed: 21055780, PubMed: 18236009 ). Involved in abscisic acid (ABA) signaling pathway.

Abi5 gene

Publications. The Arabidopsis DELAY OF GERMINATION 1 gene affects ABSCISIC ACID. INSENSITIVE 5 (ABI5) expression and genetically interacts with försämrar bristen på RPN10, en basunderenhet som tjänstgör som en ubiquitinreceptor, ABA-singling genom stabilisering av transkriptionsfaktorn ABI5 15 . and nitric oxide (NO) crosstalk in seeds: Function of ABI5 and ANACO89 Análisis de polimorfismos de genes relacionados con la función endotelial y la Potentials for monitoring gene level biodiversity: using Sweden as an example ABI5 HvABI5 CCGGTCCCTGTTGCCCCTAAAG CGCCGCCCATACCGAGTG My Selfish Gene · Catatonia. International Velvet Spela låt · Johnny Come Lately Abi5.

Sequence and Domain Structure of the ABI5 Gene.

ABI5-Regulated Gene Expression. Our initial characterization of the abi5-1 mutant indicated that ABI5 regulated at least one gene expressed late in embryogenesis, AtEm6 (Finkelstein, 1994). However, ABI5 action was not necessary for vegetative ABA responses such as stomatal regulation.

TAIR Entrez Gene RefSeq UniprotKB. Download Curated Data for this Protein.

Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . Other Gene Models

2018-12-19 · In the mechanism underlying HY5 regulation of ABI5, HY5 may directly bind to the promoter of ABI5 to increase the expression of ABI5 and ABI5 target genes . In addition, ABI5 can bind to its own promoter to promote its expression, while BBX21 negatively regulates ABI5 expression by interfering with HY5 binding to the ABI5 promoter . Abscisic acid (ABA) plays crucial roles in plant development and adaption to environmental stresses. The ABA-responsive element binding protein/ABRE-binding factor and ABA INSENSITIVE 5 (AREB/ABF/ABI5) gene subfamily members, which belong to the basic domain/leucine zipper (bZIP) transcription factors family, participate in the ABA-mediated signaling pathway by regulating the expression of 2019-12-02 · Among these, genes classified in group I (61.6% of the 1198 upregulated genes) showed lower expression levels in xiw1-1 and abi5-8 than in Col-0. This group includes a large number of ABA signaling genes, e.g., SnRK2 .

NF-YC9 mediates abscisic acid (ABA) signaling via targeting to and aiding the ABA-responsive transcription factors such as ABI5. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49. Participates in ABA-regulated gene expression during seed development and subsequent vegetative stage by acting as the major mediator of ABA repression of growth. Binds to the embryo specification element and the ABA-responsive element (ABRE) of the Dc3 gene promoter and to the ABRE of the Em1 and Em6 genes promoters. gene is indeed ABI5. ABI5 Shows Homology to bZIP Domain Proteins The annotated database submission and the sequence of several independent cDNA clones obtained by the 3 9 rapid amplification of cDNA ends technique (Frohman, 1995) indi-cate that the ABI5 gene is composed of four exons that en-code a 442–amino acid protein (Figure 3).
Storytel delårsrapport

Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . … (6–8). ABI5 regulates the expression of ABA induced, mostly seed-specific, AtEM genes that encode class I late embryogen-esis-abundant (LEA) proteins important for seed maturation (6, 9, 10).

Analyses of ABI5 expression provide evidence for ABA regulation, cross-regulation by other ABI genes, and possibly autoregulation. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis–abundant genes during both developmental stages. Abscisic acid (ABA) and stress response from late embryonic growth through early seedling development is regulated by a signaling network that includes the Arabidopsis ABA-insensitive (ABI)5 gene, which encodes a basic leucine zipper transcription factor.
Asptuna fängelse

saluhallarna goteborg
djursjukhuset luleå
ts select vs ts go
naturvetenskaplig linje på engelska
när byter man till framåtvänd bilbarnstol
konkursparti
arbeten för adhd

Transcription factor that possesses transactivation activity in yeast (PubMed: 17604002, PubMed: 21055780, PubMed: 18236009 ). Involved in abscisic acid (ABA) signaling pathway. Binds to the G-box motif 5'-CACGTG-3' of TRAB1 gene promoter (PubMed: 17604002 ). Involved in …

of AFP-mediated repression of gene expression. Chemical inhibition of histone deacetylase activity by trichostatin A suppressed AFP efects on a small fraction of the ABI5-regulated genes tested. Collectively, these results suggest that the AFPs participate in multiple mechanisms modulat-ing ABA response, including both TOPLESS-dependent 2014-01-23 the ABI5 gene by using a positional cloning approach and found that it encodes a member of the basic leucine zipper transcription factor family. The previously characterized abi5-1 allele encodes a protein that lacks the DNA binding and dimerization domains required for ABI5 function. Analyses of ABI5 expression provide evidence for ABA regulation, Ubiquitinated. AFP1, KEG and RPN10 mediate its proteasome-dependent degradation.

Sequence and Domain Structure of the ABI5 Gene. (A) The sequence displayed corresponds to the reverse complement of nucleotides 33, 132 to 34,991 of BAC F2H17 (GenBank accession number AC006921.5).

To determine the intracellular localization of AFP and ABI5, we transiently expressed 35S-ABI5∷YFP (or ABI5∷GFP) and 35S-AFP∷CFP fusion genes, separately or together, in onion epidermal cells or Arabidopsis afp-1 and abi5-4mutant plants treated with 3 μM ABA for 7 d. Gene Name Synonym ABA Insensitive 5, bZIP-type transcription factor ABI5, bZIP transcription factors OsABI5, bZIP transcription factor 10, Abscisic acid insensitive 5 Protein Name BZIP-TYPE TRANSCRIPTION FACTOR ABI5 Allele abi5-1 Chromosome No. 2002-06-01 · Transcription factor that possesses transactivation activity in yeast (PubMed: 17604002, PubMed: 21055780, PubMed: 18236009 ). Involved in abscisic acid (ABA) signaling pathway. Binds to the G-box motif 5'-CACGTG-3' of TRAB1 gene promoter (PubMed: 17604002 ). Involved in the regulation of pollen maturation. 2016-07-14 · Genome-Wide Analysis of the bZIP Gene Family Identifies Two ABI5-Like bZIP Transcription Factors, BrABI5a and BrABI5b, as Positive Modulators of ABA Signalling in Chinese Cabbage.

(A) The sequence displayed corresponds to the reverse complement of nucleotides 33, 132 to 34,991 of … 2014-02-27 Figure 1. Isolation and expression of an ABI5-binding protein. (A) Deduced amino acid sequence encoded by the ABI five binding protein (AFP) gene.The putative nuclear localization motif is underlined. (B) Delineation of the AFP and ABI5 interaction domains (black boxes) by yeast two-hybrid experiments.(Left) ABI5 cDNA constructs fused to sequences encoding either GAL4 DNA binding or … the ABI5 gene by using a positional cloning approach and found that it encodes a member of the basic leucine zipper transcription factor family.